Metadata Annotation Guidelines

Purpose of this Document

This document describes the RECOMMENDED ways to provide metadata annotation for various experimental setups.

Clarification of Terms

  • The key words “MUST”, “MUST NOT”, “REQUIRED”, “SHOULD”, “SHOULD NOT”, “RECOMMENDED”, “MAY”, and “OPTIONAL” in this document are to be interpreted as described in [RFC2119].

Individual fields

library_generation_method

The library_generation_method describes how the nucleic acid annotated in template_class that encodes the V(D)J-rearrangement it reverse-transcribed, amplified and/or otherwise prepared for further processing. Typically this procedure will precede further NGS platform- specific steps, however these procedures MAY be combined. The field uses a controlled vocabulary, the individual values are described below:

template_class

library_generation_method

Methodology

DNA

PCR

Conventional PCR on genomic DNA of a vertebrate host (requires: synthetic == false )

Conventional PCR on DNA of a synthetic library (requires: synthetic == true )

RNA

RT(RHP)+PCR

RT-PCR using random hexamer primers

RT(oligo-dT)+PCR

RT-PCR using oligo-dT primers

RT(oligo-dT)+TS+PCR

5’-RACE PCR (i.e. RT is followed by a template switch (TS) step) using oligo-dT primers

RT(oligo-dT)+TS(UMI)+PCR

5’-RACE PCR using oligo-dT primers and template switch primers containing unique molecular identifiers (UMI), i.e., the 5’ end is UMI-coded

RT(specific)+PCR

RT-PCR using transcript-specific primers

RT(specific)+TS+PCR

5’-RACE PCR using transcript- specific primers

RT(specific)+TS(UMI)+PCR

5’-RACE PCR using transcript- specific primers and template switch primers containing UMIs

RT(specific+UMI)+PCR

RT-PCR using transcript-specific primers containing UMIs (i.e., the 3’ end is UMI-coded)

RT(specific+UMI)+TS+PCR

5’-RACE PCR using transcript- specific primers containing UMIs (i.e., the 3’ end is UMI-coded)

RT(specific)+TS

RT-based generation of dsDNA without subsequent PCR. This is used by RNA-seq kits.

any

other

Any methodology not covered above

*_pcr_primer_target_location

The fields forward_pcr_primer_target_location and reverse_pcr_primer_target_location describe the location of the innermost primer used for a given locus. This information is critical to determine which positions of a sequence reflect a biological process and which are an artifact of the experiment.

The terms “proximal” and “distal” in the field description refer to the start of the respective V or C gene. Using human TRAC and a hypothetical primer as an example:

1   5    10   15   20   25   30   35   40   45   50   55  60   position (+1 = start of exon 1)
|...|....|....|....|....|....|....|....|....|....|....|....|
                   TGCCGTGTACCAGCTGAGAG                        TRAC primer (reverse complement)
ATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGT   Chr. 14:22,547,506-22,547,565 (GRCh38)
                  ^^                  ^
                [a][b]               [c]                       markers

In this case:

  • +19 (marker [a]) is the most distal untemplated nucleotide

  • +20 (marker [b]) is the most proximal templated nucleotide

  • +39 (marker [c]) is the most distal templated nucleotide

Specific Use Cases and Experimental Setups

Synthetic libraries

In synthetic libraries (e.g., phage or yeast display), particles present genetically engineered constructs (e.g., scFv fusion receptors) on their surface. As this deviates substantially from other workflows, the following annotation SHOULD/MUST be used:

  • In general, Subject should be interpreted as the initial library that undergoes a mutation/selection procedure.

  • synthetic: MUST be set to true

  • species: It is assumed that every synthetic library is derived from V and J genes that exist in some vertebrate species. This field SHOULD encode this species. Importantly, it MUST NOT encode the phage vector, the bacterial host or the comparable biological component of the library system that constitutes the presenting particle.

  • sample_type: SHOULD be NULL.

  • single_cell: Only true if individual particles are isolated and sequenced. Note that colonies or plaques, even if containing genetically identical particles, per se do not match this definition and therefore MUST be annotated as false.

  • cell_storage: SHOULD be used for non-cellular particles analogously.

  • physical_linkage: For scFv constructs the hetero_prelinkeded term MUST be used. VHH (i.e., camelid) libraries SHOULD annotate none as there is only a single rearrangement envolved.

10X Chromium

The current 10X V(D)J Kits (07/2020, Rev. G) perform a fully nested PCR, in which only the reverse primers (i.e., complementary to the constant region) are Ig/TCR specific, while the forward primers anneal to the sequence of the template switch primer. For the purpose of annotation, this is considered a gene-specific amplification, therefore such experiments SHOULD be annotated as follows:

  • single_cell: MUST be true

  • library_generation_method: SHOULD be RT(specific)+TS(UMI)+PCR

  • pcr_target MAY contain multiple entries, one for each locus that is potentially amplified. Within each entry (i.e., each PCRTarget object) the following annotations SHOULD be provided:

    • pcr_target_locus: The locus described by this object, using the controlled vocabulary defined in the AIRR schema. Note that each object can only describe one locus, multiple loci require multiple PCRTarget objects.

    • forward_pcr_primer_target_location: NULL (as it cannot be reliably determined.

    • reverse_pcr_primer_target_location: Locus and position according to the respective set of reverse primers.