Metadata Annotation Guidelines
Contents
Metadata Annotation Guidelines#
Purpose of this Document#
This document describes the RECOMMENDED ways to provide metadata annotation for various experimental setups.
Clarification of Terms#
The key words “MUST”, “MUST NOT”, “REQUIRED”, “SHOULD”, “SHOULD NOT”, “RECOMMENDED”, “MAY”, and “OPTIONAL” in this document are to be interpreted as described in [RFC2119].
Individual fields#
library_generation_method#
The library_generation_method describes how the nucleic acid
annotated in template_class that encodes the V(D)J-rearrangement
it reverse-transcribed, amplified and/or otherwise prepared for further
processing. Typically this procedure will precede further NGS platform-
specific steps, however these procedures MAY be combined. The field
uses a controlled vocabulary, the individual values are described below:
|
|
Methodology |
|---|---|---|
|
|
Conventional PCR on genomic DNA
of a vertebrate host (requires:
|
Conventional PCR on DNA of a
synthetic library (requires:
|
||
|
|
RT-PCR using random hexamer primers |
|
RT-PCR using oligo-dT primers |
|
|
5’-RACE PCR (i.e. RT is followed by a template switch (TS) step) using oligo-dT primers |
|
|
5’-RACE PCR using oligo-dT primers and template switch primers containing unique molecular identifiers (UMI), i.e., the 5’ end is UMI-coded |
|
|
RT-PCR using transcript-specific primers |
|
|
5’-RACE PCR using transcript- specific primers |
|
|
5’-RACE PCR using transcript- specific primers and template switch primers containing UMIs |
|
|
RT-PCR using transcript-specific primers containing UMIs (i.e., the 3’ end is UMI-coded) |
|
|
5’-RACE PCR using transcript- specific primers containing UMIs (i.e., the 3’ end is UMI-coded) |
|
|
RT-based generation of dsDNA without subsequent PCR. This is used by RNA-seq kits. |
|
any |
|
Any methodology not covered above |
*_pcr_primer_target_location#
The fields forward_pcr_primer_target_location and
reverse_pcr_primer_target_location describe the location of the
innermost primer used for a given locus. This information is critical
to determine which positions of a sequence reflect a biological process
and which are an artifact of the experiment.
The terms “proximal” and “distal” in the field description refer to the start of the respective V or C gene. Using human TRAC and a hypothetical primer as an example:
1 5 10 15 20 25 30 35 40 45 50 55 60 position (+1 = start of exon 1)
|...|....|....|....|....|....|....|....|....|....|....|....|
TGCCGTGTACCAGCTGAGAG TRAC primer (reverse complement)
ATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGT Chr. 14:22,547,506-22,547,565 (GRCh38)
^^ ^
[a][b] [c] markers
In this case:
+19 (marker
[a]) is the most distal untemplated nucleotide+20 (marker
[b]) is the most proximal templated nucleotide+39 (marker
[c]) is the most distal templated nucleotide
cell_subset#
The cell_subset field is ontology-controlled, i.e., if present, it
MUST refer to a Cell Ontology (CL) term via its id field. The field
SHOULD NOT be used for values other than lymphocyte (CL:0000542) and
its descendents. The reasoning behind this is that rearrangements of
IG and TR loci are typically confined to this population, so that other
nodes, do not provide further information. In addition, the field SHOULD
only be used if the subset has been purified to a level that is
comparable to flow cytometric cell sorting.
In general, the provided annotation MUST NOT contradict the experimentally determined phenotype. E.g., if the experiment shows that the population is CD27+ a term that is explicitly defined in CL as CD27- MUST NOT be used.
However, this does not mean that all markers listed in the description of an ontology term need to be confirmed, as long as the existing information is considered sufficient for classification and not contradictory (see above).
In case the experimentally isolated cells to not match any “leaf” term, e.g., due to the isolation of multiple populations that contradict the definitions, the general advice is to move up the CL hierarchy to the most distal term that is no-contradictory. In this case,
cell_phenotypeshould be used to define the markers that were used experimentally.Note that ontology-controlled fields allow exactly one term. Therefore, mixtures of defined cell populations either need to be demultiplexed, or – if this is not possible – use the last (i.e,, most distal) common term of all cell populations involved. Again,
cell_phenotypecan be used to provide the markers used in the experiment.
Specific Use Cases and Experimental Setups#
Peripheral Blood Mononuclear Cells (PBMCs)#
PBMCs are frequently used starting material for AIRR-seq studies in humans and are prepared by a density-gradient centrifugation using Ficoll. As they constitute a mixture of myeloid and lymphoid cells, the following points should be taken into consideration when annotating experiments using PBMCs:
The
cell_populationandcell_phenotypefields should beNULLas PBMCs are neither sufficiently pure nor do they exclusively contain cells of the lymphocytic lineage (see cell_subset).Note that while Cell Ontology does provide a term
peripheral blood mononuclear cell(CL:2000001), this is a sister node oflymphocyte(CL:0000542) and therefore outside of the current specification.The typical annotation for PBMC is therefore as follows:
sample_type:"peripheral venous puncture" tissue: label:"venous blood" id:"UBERON:0013756" tissue_processing"Ficoll gradient" cell_subset:NULL cell_phenotype:NULL
Synthetic libraries#
In synthetic libraries (e.g., phage or yeast display), particles present genetically engineered constructs (e.g., scFv fusion receptors) on their surface. As this deviates substantially from other workflows, the following annotation SHOULD/MUST be used:
In general,
Subjectshould be interpreted as the initial library that undergoes a mutation/selection procedure.synthetic: MUST be set totruespecies: It is assumed that every synthetic library is derived from V and J genes that exist in some vertebrate species. This field SHOULD encode that species. Importantly, it MUST NOT encode the phage vector, the bacterial host or a comparable biological component of the library system that constitutes the presenting particle.sample_type: SHOULD beNULL.single_cell: Onlytrueif individual particles are isolated and sequenced. Note that colonies or plaques, even if containing genetically identical particles, per se do not match this definition and therefore MUST be annotated asfalse.cell_storage: SHOULD be used for non-cellular particles analogously.physical_linkage: For scFv constructs thehetero_prelinkededterm MUST be used. VHH (i.e., camelid) libraries SHOULD annotatenoneas there is only a single rearrangement envolved.
10X Chromium#
The current 10X V(D)J Kits (07/2020, Rev. G) perform a fully nested PCR, in which only the reverse primers (i.e., complementary to the constant region) are Ig/TCR specific, while the forward primers anneal to the sequence of the template switch primer. For the purpose of annotation, this is considered a gene-specific amplification, therefore such experiments SHOULD be annotated as follows:
single_cell: MUST betruelibrary_generation_method: SHOULD beRT(specific)+TS(UMI)+PCRpcr_targetMAY contain multiple entries, one for each locus that is potentially amplified. Within each entry (i.e., eachPCRTargetobject) the following annotations SHOULD be provided:pcr_target_locus: The locus described by this object, using the controlled vocabulary defined in the AIRR schema. Note that each object can only describe one locus, multiple loci require multiplePCRTargetobjects.forward_pcr_primer_target_location:NULL(as it cannot be reliably determined.reverse_pcr_primer_target_location: Locus and position according to the respective set of reverse primers.