MiAIRR Data Elements

The AIRR Community has agreed to six high-level data sets that will guide the publication, curation and sharing of AIRR-Seq data and metadata: Study and subject, sample collection, sample processing and sequencing, raw sequences, processing of sequence data, and processed AIRR sequences.

Download as TSV.

Set	Subset	Designation	Field	Type	Format	Definition	Example
1	study	Study ID	study_id	string	Free text	Unique ID assigned by study registry	PRJNA001
1	study	Study title	study_title	string	Free text	Descriptive study title	Effects of sun light exposure of the Treg repertoire
1	study	Study type	study_type	string	Ontology: { name: NCIT, top_node: {id: C15320, value: Study Design}, draft: True, url: https://ncit.nci.nih.gov/ncitbrowser/ }	Type of study design	id: C15197, value: Case-Control Study
1	study	Study inclusion/exclusion criteria	inclusion_exclusion_criteria	string	Free text	List of criteria for inclusion/exclusion for the study	Include: Clinical P. falciparum infection; Exclude: Seropositive for HIV
1	study	Grant funding agency	grants	string	Free text	Funding agencies and grant numbers	NIH, award number R01GM987654
1	study	Contact information (data collection)	collected_by	string	Free text	Full contact information of the data collector, i.e. the person who is legally responsible for data collection and release. This should include an e-mail address.	Dr. P. Stibbons, p.stibbons@unseenu.edu
1	study	Lab name	lab_name	string	Free text	Department of data collector	Department for Planar Immunology
1	study	Lab address	lab_address	string	Free text	Institution and institutional address of data collector	School of Medicine, Unseen University, Ankh-Morpork, Disk World
1	study	Contact information (data deposition)	submitted_by	string	Free text	Full contact information of the data depositor, i.e. the person submitting the data to a repository. This is supposed to be a short-lived and technical role until the submission is relased.	Adrian Turnipseed, a.turnipseed@unseenu.edu
1	study	Relevant publications	pub_ids	string	Free text	Publications describing the rationale and/or outcome of the study	PMID:85642
1	study	Keywords for study	keywords_study	array	Free text	Keywords describing properties of one or more data sets in a study	[‘contains_ig’, ‘contains_paired_chain’]
1	subject	Subject ID	subject_id	string	Free text	Subject ID assigned by submitter, unique within study	SUB856413
1	subject	Synthetic library	synthetic	boolean	T | F	TRUE for libraries in which the diversity has been synthetically generated (e.g. phage display)
1	subject	Organism	organism	string	Ontology: { name: NCBITAXON, top_node: {id: 7776, value: Gnathostomata}, draft: False, url: https://www.ncbi.nlm.nih.gov/taxonomy }	Binomial designation of subject’s species	id: 9096, value: Homo sapiens
1	subject	Sex	sex	string	Controlled vocabulary: [‘male’, ‘female’, ‘pooled’, ‘hermaphrodite’, ‘intersex’, ‘not collected’, ‘not applicable’]	Biological sex of subject	female
1	subject	Age minimum	age_min	number	Any positive number	Specific age or lower boundary of age range.	60
1	subject	Age maximum	age_max	number	Any positive number	Upper boundary of age range or equal to age_min for specific age. This field should only be null if age_min is null.	80
1	subject	Age unit	age_unit	string	Ontology: { name: Units of measurement ontology, top_node: {id: UO_0000003, value: time unit}, draft: True, url: http://www.ontobee.org/ontology/UO }	Unit of age range	id: UO_0000036, value: year
1	subject	Age event	age_event	string	Free text	Event in the study schedule to which Age refers. For NCBI BioSample this MUST be sampling. For other implementations submitters need to be aware that there is currently no mechanism to encode to potential delta between Age event and Sample collection time, hence the chosen events should be in temporal proximity.	enrollment
1	subject	Ancestry population	ancestry_population	string	Free text	Broad geographic origin of ancestry (continent)	list of continents, mixed or unknown
1	subject	Ethnicity	ethnicity	string	Free text	Ethnic group of subject (defined as cultural/language-based membership)	English, Kurds, Manchu, Yakuts (and other fields from Wikipedia)
1	subject	Race	race	string	Free text	Racial group of subject (as defined by NIH)	White, American Indian or Alaska Native, Black, Asian, Native Hawaiian or Other Pacific Islander, Other
1	subject	Strain name	strain_name	string	Free text	Non-human designation of the strain or breed of animal used	C57BL/6J
1	subject	Relation to other subjects	linked_subjects	string	Free text	Subject ID to which Relation type refers	SUB1355648
1	subject	Relation type	link_type	string	Free text	Relation between subject and linked_subjects, can be genetic or environmental (e.g.exposure)	father, daughter, household
1	diagnosis and intervention	Study group description	study_group_description	string	Free text	Designation of study arm to which the subject is assigned to	control
1	diagnosis and intervention	Diagnosis	disease_diagnosis	string	Free text	Diagnosis of subject	Multiple myeloma
1	diagnosis and intervention	Length of disease	disease_length	string	Physical quantity	Time duration between initial diagnosis and current intervention	23 months
1	diagnosis and intervention	Disease stage	disease_stage	string	Free text	Stage of disease at current intervention	Stage II
1	diagnosis and intervention	Prior therapies for primary disease under study	prior_therapies	string	Free text	List of all relevant previous therapies applied to subject for treatment of Diagnosis	melphalan/prednisone
1	diagnosis and intervention	Immunogen/agent	immunogen	string	Free text	Antigen, vaccine or drug applied to subject at this intervention	bortezomib
1	diagnosis and intervention	Intervention definition	intervention	string	Free text	Description of intervention	systemic chemotherapy, 6 cycles, 1.25 mg/m2
1	diagnosis and intervention	Other relevant medical history	medical_history	string	Free text	Medical history of subject that is relevant to assess the course of disease and/or treatment	MGUS, first diagnosed 5 years prior
2	sample	Biological sample ID	sample_id	string	Free text	Sample ID assigned by submitter, unique within study	SUP52415
2	sample	Sample type	sample_type	string	Free text	The way the sample was obtained, e.g. fine-needle aspirate, organ harvest, peripheral venous puncture	Biopsy
2	sample	Tissue	tissue	string	Free text	The actual tissue sampled, e.g. lymph node, liver, peripheral blood	Bone marrow
2	sample	Anatomic site	anatomic_site	string	Free text	The anatomic location of the tissue, e.g. Inguinal, femur	Iliac crest
2	sample	Disease state of sample	disease_state_sample	string	Free text	Histopathologic evaluation of the sample	Tumor infiltration
2	sample	Sample collection time	collection_time_point_relative	string	Physical quantity	Time point at which sample was taken, relative to Collection time event	14 d
2	sample	Collection time event	collection_time_point_reference	string	Free text	Event in the study schedule to which Sample collection time relates to	Primary vaccination
2	sample	Biomaterial provider	biomaterial_provider	string	Free text	Name and address of the entity providing the sample	Tissues-R-Us, Tampa, FL, USA
3	process (cell)	Tissue processing	tissue_processing	string	Free text	Enzymatic digestion and/or physical methods used to isolate cells from sample	Collagenase A/Dnase I digested, followed by Percoll gradient
3	process (cell)	Cell subset	cell_subset	string	Ontology: { name: CL, top_node: {id: CL_0000542, value: lymphocyte}, draft: True, url: https://www.ebi.ac.uk/ols/ontologies/cl }	Commonly-used designation of isolated cell population	id: CL_0000972, value: class switched memory B cell
3	process (cell)	Cell subset phenotype	cell_phenotype	string	Free text	List of cellular markers and their expression levels used to isolate the cell population	CD19+ CD38+ CD27+ IgM- IgD-
3	process (cell)	Single-cell sort	single_cell	boolean	T | F	TRUE if single cells were isolated into separate compartments
3	process (cell)	Number of cells in experiment	cell_number	integer	Any positive integer	Total number of cells that went into the experiment	1000000
3	process (cell)	Number of cells per sequencing reaction	cells_per_reaction	integer	Any positive integer	Number of cells for each biological replicate	50000
3	process (cell)	Cell storage	cell_storage	boolean	T | F	TRUE if cells were cryo-preserved between isolation and further processing	True
3	process (cell)	Cell quality	cell_quality	string	Free text	Relative amount of viable cells after preparation and (if applicable) thawing	90% viability as determined by 7-AAD
3	process (cell)	Cell isolation / enrichment procedure	cell_isolation	string	Free text	Description of the procedure used for marker-based isolation or enrich cells	Cells were stained with fluorochrome labeled antibodies and then sorted on a FlowMerlin (CE) cytometer
3	process (cell)	Processing protocol	cell_processing_protocol	string	Free text	Description of the methods applied to the sample including cell preparation/ isolation/enrichment and nucleic acid extraction. This should closely mirror the Materials and methods section in the manuscript	Stimulated wih anti-CD3/anti-CD28
3	process (nucleic acid [pcr])	Target locus for PCR	pcr_target_locus	string	Controlled vocabulary: [‘IGH’, ‘IGI’, ‘IGK’, ‘IGL’, ‘TRA’, ‘TRB’, ‘TRD’, ‘TRG’]	Designation of the target locus according to IMGT nomencleature	IGK
3	process (nucleic acid [pcr])	Forward PCR primer target location	forward_pcr_primer_target_location	string	Free text	Position of the most distal nucleotide templated by the forward primer or primer mix	IGHV, +23
3	process (nucleic acid [pcr])	Reverse PCR primer target location	reverse_pcr_primer_target_location	string	Free text	Position of the most proximal nucleotide templated by the reverse primer or primer mix	IGHG, +57
3	process (nucleic acid)	Target substrate	template_class	string	Controlled vocabulary: [‘DNA’, ‘RNA’]	The class of nucleic acid that was used as primary starting material for the following procedures	RNA
3	process (nucleic acid)	Target substrate quality	template_quality	string	Free text	Description and results of the quality control performed on the template material	RIN 9.2
3	process (nucleic acid)	Template amount	template_amount	string	Physical quantity	Amount of template that went into the process	1000 ng
3	process (nucleic acid)	Library generation method	library_generation_method	string	Controlled vocabulary: [‘PCR’, ‘RT(RHP)+PCR’, ‘RT(oligo-dT)+PCR’, ‘RT(oligo-dT)+TS+PCR’, ‘RT(oligo-dT)+TS(UMI)+PCR’, ‘RT(specific)+PCR’, ‘RT(specific)+TS+PCR’, ‘RT(specific)+TS(UMI)+PCR’, ‘RT(specific+UMI)+PCR’, ‘RT(specific+UMI)+TS+PCR’, ‘RT(specific)+TS’, ‘other’]	Generic type of library generation	RT(oligo-dT)+TS(UMI)+PCR
3	process (nucleic acid)	Library generation protocol	library_generation_protocol	string	Free text	Description of processes applied to substrate to obtain a library that is ready for sequencing	cDNA was generated using
3	process (nucleic acid)	Protocol IDs	library_generation_kit_version	string	Free text	When using a library generation protocol from a commercial provider, provide the protocol version number	v2.1 (2016-09-15)
3	process (nucleic acid)	Complete sequences	complete_sequences	string	Controlled vocabulary: [‘partial’, ‘complete’, ‘complete+untemplated’]	To be considered complete, the procedure used for library construction MUST generate sequences that 1) include the first V segment codon that encodes the mature polypeptide chain (i.e. after the leader sequence) and 2) include the last complete codon of the J segment (i.e. 1 bp 5’ of the J->C splice site) and 3) provide sequence information for all positions between 1) and 2). To be considered complete & untemplated, the sections of the sequences defined in points 1) to 3) of the previous sentence MUST be untemplated, i.e. MUST NOT overlap with the primers used in library preparation.	partial
3	process (nucleic acid)	Physical linkage of different loci	physical_linkage	string	Controlled vocabulary: [‘none’, ‘hetero_head-head’]	Describes the mode of linkage if a method was used which physically links nucleic acids derived from distinct loci in a single-cell context.	hetero_head-head
3	process (sequencing)	Batch number	sequencing_run_id	string	Free text	ID of sequencing run assigned by the sequencing facility	160101_M01234_0201_000000000-D2T7V
3	process (sequencing)	Total reads passing QC filter	total_reads_passing_qc_filter	integer	Any positive integer	Number of usable reads for analysis	10365118
3	process (sequencing)	Sequencing platform	sequencing_platform	string	Free text	Designation of sequencing instrument used	Alumina LoSeq 1000
3	process (sequencing)	Read lengths	read_length	string	Free text	Read length in bases for each direction	[300,300]
3	process (sequencing)	Sequencing facility	sequencing_facility	string	Free text	Name and address of sequencing facility	Seqs-R-Us, Vancouver, BC, Canada
3	process (sequencing)	Date of sequencing run	sequencing_run_date	string	Free text	Date of sequencing run	2016-12-16
3	process (sequencing)	Sequencing kit	sequencing_kit	string	Free text	Name, manufacturer, order and lot numbers of sequencing kit	FullSeq 600, Alumina, #M123456C0, 789G1HK
4	data (raw reads)	Raw sequencing data file type	file_type	string	Controlled vocabulary: [‘fasta’, ‘fastq’]	File format for the raw reads or sequences
4	data (raw reads)	Raw sequencing data file name	filename	string	Free text	File name for the raw reads or sequences. The first file in paired-read sequencing	MS10R-NMonson-C7JR9_S1_R1_001.fastq
4	data (raw reads)	Read direction	read_direction	string	Controlled vocabulary: [‘forward’, ‘reverse’, ‘mixed’]	Read direction for the raw reads or sequences. The first file in paired-read sequencing	forward
4	data (raw reads)	Raw sequencing data file name	paired_filename	string	Free text	File name for the second file in paired-read sequencing	MS10R-NMonson-C7JR9_S1_R2_001.fastq
4	data (raw reads)	Read direction	paired_read_direction	string	Controlled vocabulary: [‘forward’, ‘reverse’, ‘mixed’]	Read direction for the second file in paired-read sequencing	reverse
5	process (computational)	Software tools and version numbers	software_versions	string	Free text	Version number and / or date, include company pipelines	IgBLAST 1.6
5	process (computational)	Paired read assembly	paired_reads_assembly	string	Free text	How paired end reads were assembled into a single receptor sequence	PandaSeq (minimal overlap 50, threshold 0.8)
5	process (computational)	Quality thresholds	quality_thresholds	string	Free text	How sequences were removed from (4) based on base quality scores	Average Phred score >=20
5	process (computational)	Primer match cutoffs	primer_match_cutoffs	string	Free text	How primers were identified in the sequences, were they removed/masked/etc?	Hamming distance <= 2
5	process (computational)	Collapsing method	collapsing_method	string	Free text	The method used for combining multiple sequences from (4) into a single sequence in (5)	MUSCLE 3.8.31
5	process (computational)	Data processing protocols	data_processing_protocols	string	Free text	General description of how QC is performed	Data was processed using […]
5	data (processed sequence)	V(D)J germline reference database	germline_database	string	Free text	Source of germline V(D)J genes with version number or date accessed.	ENSEMBL, Homo sapiens build 90, 2017-10-01
6	data (processed sequence)	V gene	v_call	string	Free text	V gene with allele. If referring to a known reference sequence in a database, such as IMGT/GENE-DB, the relevant gene/allele nomenclature should be followed (e.g., IGHV4-59*01).	IGHV4-59*01
6	data (processed sequence)	D gene	d_call	string	Free text	D gene with allele. If referring to a known reference sequence in a database, such as IMGT/GENE-DB, the relevant gene/allele nomenclature should be followed (e.g., IGHD3-10*01).	IGHD3-10*01
6	data (processed sequence)	J gene	j_call	string	Free text	J gene with allele. If referring to a known reference sequence in a database, such as IMGT/GENE-DB, the relevant gene/allele nomenclature should be followed (e.g., IGHJ4*02).	IGHJ4*02
6	data (processed sequence)	C region	c_call	string	Free text	C region gene with allele. If referring to a known reference sequence in a database, such as IMGT/GENE-DB, the relevant gene/allele nomenclature should be followed (e.g., IGHM*01).	IGHM*01
6	data (processed sequence)	IMGT-JUNCTION nucleotide sequence	junction	string	Free text	Junction region nucleotide sequence, where the junction is defined as the CDR3 plus the two flanking conserved codons.	TGTGCAAGAGCGGGAGTTTACGACGGATATACTATGGACTACTGG
6	data (processed sequence)	IMGT-JUNCTION amino acid sequence	junction_aa	string	Free text	Junction region amino acid sequence.	CARAGVYDGYTMDYW
6	data (processed sequence)	Read count	duplicate_count	integer	Any positive integer	Copy number or number of duplicate observations for the query sequence. For example, the number of UMIs sharing an identical sequence or the number of identical observations of this sequence absent UMIs.	123
6	data (processed sequence)	Paired-chain index	pair_id	string	Free text	Valid sequence_id that was determined by experimental or computational means to be associated with the current Rearrangement on the cellular level.	ABC314159
6	data (processed sequence)	Cell index	cell_id	string	Free text	Identifier defining the cell of origin for the query sequence.	W06_046_091